interpretation of the principle is proposed which results from the assumption that the actual movement ... table (Calcomp, 622 RP) connected to an HP ZlMX-E computer. ... on the example of trajectory shown in A. The quantities r and V (left panels) were calculated from the ..... On the basis of point 3 above, we will refer to the.
Nmwwrtw(t) were calculated by the Lagrange polynomial method, after smoothing the raw data with a double-exponential, numerical low-pass filter (cut-off frequency: 50 Hz).
* Note: The term Dynamics refers to the time changes of forces and torques, while the term Kinematics refers to the time changes of position, velocity and acceleration, Throughout the paper the first term will be used to emphasize the motor plan which specifies forces and torques. The
RESULTS Figure 1 illustrates the basic finding with the help of two simple examples: an isolated letter (A) and a segment of scribble (B). In each case the two plots on
term Kinematics will instead be used to emphasize the geometrical parameters of the resulting trajectory. 431
432
P. Viviani and C. Terzuolo
cmlsec 30 20 cm 4
10 ._
V
0
3 r 2
I 0I
‘..
L
.o Fig. 1. Relationship
--
I
1
1
1
.l
.2
.3
.4
figural
and kimematic
between
I
.5 set aspects
of handwriting
and scribbling
movements.
The instantaneous radius of curvature r(r) and the modulus of the tangential velocity l’(t) completely describe the figural and kinematic aspects of the movement respectively, while the time course of the angle cc(r) of the tangent to the trajectory resumes both these aspects. These three quantities are identified on the example of trajectory shown in A. The quantities r and V (left panels) were calculated from the instantaneous coordinates x(t) and p(t) recorded by the digitizing table. The relevant result shown in this Figure is the great similarity between the time course of r and V both in the case of a letter (A) and of a segment of extemporaneously generated scribble (B). Numbers on the trajectories permit to identify the corresponding kinematic events. Notice the presence of two singularities in the movement: the cuspid (point 5 in A), where the tangential velocity goes to zero, and the point of inflection (point 6 in B) where the radius of curvature becomes infinite.
the left represent the time course of the radius of curvature of the trajectory (curve labelled r) and the modulus of the tangential velocity I/ (curve labelled V). The geometrical meaning of these quantities and that of the phase angle c( are illustrated in A. Numbers provide the relationship between points along the trajectories and the corresponding values of r(t) and P’(t). The relevant finding illustrated by the figure is the striking similarity between the time evolution of r and V. This similarity was observed in all cases: isolated letters, words and scribbles. Thus, in the case of both learned, continuous movements and spontaneouslygenerated scribbles, a constraining principle exists whereby the figural and dynamical aspects of the movement are reciprocally related. This relation between the modulus of the tangential velocity and the radius of curvature is robust in the sense that it holds even when some types of external constraints are imposed on the movement (see later). As a first approximation, the empirically-observed relation between r(t) and v(t) can be expressed as: v(t) = kr(t)
CONCLUSIONS. 1. Arm movements toward a target in- volving motion at the shoulder and elbow joints and restricted to the sagittal plane were investigated.
answer the following questions: (1) Can cartels succeed? (2) If so, for .... ation, a cartel immediately faces three key ..... 21 This line of research follows from Richard A. ..... sugar industry, see Alfred S. Eichner (1969) and David .... teenth c
to benefit from the rights and privileges arising from their subscription to .... purpose of using and participating to the information and management system.
Mar 18, 2003 - reported which of two 750-ms presentations contained .... These reports either did not make and haptic thresholds ... ad hoc strategies. The fact ...
Situation : You have an animation on one or more objects. What the script do? - Show the ... current frame) you want the trajectory represents. and how many in ...
Journal of Experimental Psychology: Human Perception and Performance, ... patiently explaining its use. ...... for the widths approached statistical significance.
previous findings that have shown that the mean reaction ... movements, trajectories simulated on the basis of the ..... subject was seated in front of the table.
auditory metronome we show that the nervous system produces trajectories that are asymmetric with respect to time and velocity in the out and return phases of ...
for tuba and rhythm section (2005 - 9'). Written for and commissioned by Velvet Brown. (electric guitar, bass guitar, triangle, finger cymbals, snare drum, bass ...
(rZ0.240, PZ0.212, NZ29). To test whether it was the direction or the magnitude of the reported effect that affected the citation rates, we recalculated correlations ...
Aug 20, 1998 - proposed that this saturation arises from limits on the control ... duration, signal-dependent noise places a lower limit on the final ..... understand how the neural activity in these numerous active ..... and is often ignored. The ..
Aug 20, 1998 - GAG and CTGATTTTCGCGATGTAGCC amplify a 117-bp product that includes three ... cDNA libraries prepared from adult male dog liver (Clontech) and adult .... mized by making the movement as rapidly as possible, as in bang- .... the eye is
May 7, 2007 - Our data demonstrate essential roles for syndecan-4 in both the spatial localization of Rac1 activation in response to ECM en- gagement and in ...
tion of volatility degrees of freedom that cannot be hedged by the spot. By variationally .... comparison with local volatility models. ... This materi- alises in the fact ...
continuous opinions; typical examples are the evaluation of economic profits among different possible choices [5], ..... Rather than averaging some index over.
used a transient finite element (FE) heat-transfer model. The heat- transfer problem is modeled as shown in Fig. 6. The TPS is composed of the main core ...
[SEN 95] Sente, P., Buyse, H., "From smart sensors to smart actuators: application of digital encoders for position and speed measurements in numerical control ...
knee or trunk, suggesting a subordinate role of the focal component with respect to the primary role of the equilibrium ... brium constraints were tested as variables that determine the ... tatively using an evaluation of the ratio of maximum to.
and rate) at network ingress point. A VL definition includes the Bandwidth Allocation Gap (BAG), the minimum and the maximum frame length (smin and smax).
Nov 18, 2004 - simulations. A recent example of the local control procedure30 defines a performance index in terms of the system's wave function or density matrix operator and of the target observables. ... value of the operator O. We will keep the w
vibrational state to the first vibrational state in a .... Let us use the previous Lyapunov control in order to trap our system in the first eigen-state Ï = (1, 0, 0) of ...