The ES* sample revealed two bands corresponding to the higher molecular weight crosslinked complex and to residual free substrate. Band quantification ...
Supplementary Figure S1. Analysis of the PRORP / tRNA complex used in the footprinting analysis. (a) The crosslinked PRORP / tRNA complex (ES*) was analysed on a denaturing polyacrylamide gel together with 1, 0.1 and 0.01 mg of free tRNA substrate (S). The ES* sample revealed two bands corresponding to the higher molecular weight crosslinked complex and to residual free substrate. Band quantification showed that only 1% of the total signal was present as free substrate. (b) In order to show that the PRORP / tRNA complex analysed during footprinting experiments corresponds to a functional complex, a PRORP / tRNA sample in footprinting buffer (ES) was taken just prior to the crosslink step, incubated 15’ at RT and analysed by denaturing PAGE. This revealed that RNase P cleavage had taken place and thus showed that the protein / tRNA complex used in the footprint analysis is an active complex. Molecular weight markers are indicated in nucleotides
Supplementary Figure S2 Alignment of PRORP 1-2-3 with template structures identified by Phyre224. The best solution for the N-terminal PPR domain was the TPR domain of the murine cleavage stimulation factor (PDBid 2ooe; sequence identity of 10% with PRORP2; Phyre2 confidence score: 99.0%). The best solution for the C-terminal NYN domain was the catalytic domain of MCPIP1 RNase (PDB id 3v32; sequence identity with PRORP2: 25%; Phyre2 confidence score: 99.9%). Secondary structure predictions for PRORP2 are represented (α-helices in blue, β-strands in orange). Zinc coordinating residues are highlighted in yellow and conserved catalytic aspartates in red.
Supplementary Figure S3. RNase P activity of zinc binding mutants. Cleavage assays were carried out with PRORP proteins mutated at positions involved in zinc binding. Reactions were performed without protein (-), with wild type PRORP1 (WT), with point mutants C344A (344), C347A (347), H548A (548) and C565A (565). Apart from mutant 565, which also has the most reduced zinc content, all the other PRORP mutants had unaffected RNase P activity. Molecular weight markers are indicated in nucleotides.
Supplementary Table S1. Oligonucleotides used for mutagenesis of tRNA and PRORP sequences. Precursors of Arabidopsis thaliana mitochondrial tRNA Cys ptrnCm_G1C_FW GGTGGCGGGTTTCGCTAGGTAACAT ptrnCm_G1C_RV
of tyrosine from Tyr-AMP to tRNATyr, and the KMSKS sequence is involved in this transfer only .... protein S4 and its structure is new among the aminoacyl-tRNA .... of tyrosine or tRNATyr, and forms only one molecule of Tyr-AMP per molecule ...
These experiments have shown the existence of an equilibrium between the ... At the beginning, some basic residues of Bst-TyrRS were assumed to form salt .... 1) Chemical studies have shown that the formation of Tyr-AMP from tyrosine and ...
Purification was done as described under condi- .... active variant eventually led to high quality ... purified from yeast and in the truncated AspRS-70 form.
allowed us to trace a Ca backbone for the dimer. (results not .... addition, the Ca backbone of the present tetragonal structure is ..... containing 20% (w/v) glycerol.
Oct 7, 1985 - constructed by annealing the HN45 primer to the M13 template, extending the primer for 4 hr with DNA polymerase. I (Klenow fragment) in the ...
isolated form of the C-terminal domain, TyrRS(3), has sec- ondary structure ... 1998 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in ...... one notes that the above correlations were established with proteins that ...
Mar 16, 2007 - Cloning, overproduction and protein characterization. Two forms of ... and reservoir solutions) were equilibrated by vapour diffusion against.
Feb 28, 2009 - correlated with clear-cut structural features in the catalytic site as deduced from docking experiments, ... journal homepage: www.elsevier.com/locate/biochi .... Comparison of the chemical structures of aspartyl-adenylate and its two
Growth Des., 2008, 8 (12), 4297-4306 ⢠Publication Date (Web): 11 November 2008 ... Rossmann fold and those of class II a structural motif consisting.
Sep 11, 2007 - (from OptisaltTM additive screen, Qiagen). ... Crystals were mounted in cryoloops (Hampton Research) and flash-frozen in a nitrogen stream ...
Feb 6, 2007 - INTRODUCTION ... enzymes, chitin-agarose, pTYB11 vector and E. coli .... by separate multiple sequence alignments. ... the question of their conformational homology. ... answer came from an immunological approach. ..... Chapter 20, ...
Rencontres internationales du documentaire de Montréal (RIDM), volet Écocaméra, le 15 novembre dernier à ... carburant pour les automobiles. Pour plus ... En ce sens, Nature Québec s'est joint à la Fédération des producteurs de bois du ...
get new technologies, live longer and healthier lives, and gain deeper knowledge of our planet and the Universe. The issue of how to evaluate the fruits of ...
19 févr. 2014 - l'environnement fragile de l'île d'Anticosti », a déclaré Christian Simard de Nature Québec en réaction aux propos du ministre Yves-François ...
19 nov. 2013 - Grâce à l'importation de biomasse, le Royaume-Uni tente d'atteindre la cible fixée pour toute l'Union européenne en matière de lutte aux ...
Earlier this year, at a symposium organized by Nature in. Melbourne, Australia, a group of leading academics, funders and government advisers discussed how ...
from the California earthquake sequence of April to June 1992. ... R. A. & Simpson, R. W. Changes in static stress on southern California faults after the 1992.
24 avr. 2017 - Return clean water to nature compliant with Danone âClean Water Standardsâ. (CWS) for wastewater. 63% of sites compliant with CWS ...